|
Promega
promoter dna sequence (-187 to +310) of human brca2 gene ![]() Promoter Dna Sequence ( 187 To +310) Of Human Brca2 Gene, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/promoter dna sequence (-187 to +310) of human brca2 gene/product/Promega Average 90 stars, based on 1 article reviews
promoter dna sequence (-187 to +310) of human brca2 gene - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
AnaSpec
peptide representing amino acid residues 980–993 (dkipeknndymnkw) of the brca2 sequence ![]() Peptide Representing Amino Acid Residues 980–993 (Dkipeknndymnkw) Of The Brca2 Sequence, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/peptide representing amino acid residues 980–993 (dkipeknndymnkw) of the brca2 sequence/product/AnaSpec Average 90 stars, based on 1 article reviews
peptide representing amino acid residues 980–993 (dkipeknndymnkw) of the brca2 sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Microsynth ag
primers brca1 fw 5’acacaggtttggagtatgcaaacagc3’ and rv 5’tgcaaggaaggattttcgggttcac3 ![]() Primers Brca1 Fw 5’acacaggtttggagtatgcaaacagc3’ And Rv 5’tgcaaggaaggattttcgggttcac3, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers brca1 fw 5’acacaggtttggagtatgcaaacagc3’ and rv 5’tgcaaggaaggattttcgggttcac3/product/Microsynth ag Average 90 stars, based on 1 article reviews
primers brca1 fw 5’acacaggtttggagtatgcaaacagc3’ and rv 5’tgcaaggaaggattttcgggttcac3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Oxford Gene Technology
targeted capture sequencing of brca 2 ![]() Targeted Capture Sequencing Of Brca 2, supplied by Oxford Gene Technology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/targeted capture sequencing of brca 2/product/Oxford Gene Technology Average 90 stars, based on 1 article reviews
targeted capture sequencing of brca 2 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
OncorMed Inc
full-length sequences of brca2 ![]() Full Length Sequences Of Brca2, supplied by OncorMed Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/full-length sequences of brca2/product/OncorMed Inc Average 90 stars, based on 1 article reviews
full-length sequences of brca2 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
ExOne GmbH
brca2 gene sequencing ![]() Brca2 Gene Sequencing, supplied by ExOne GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/brca2 gene sequencing/product/ExOne GmbH Average 90 stars, based on 1 article reviews
brca2 gene sequencing - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Sequences of the oligonucleotides used in this study.
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Sequencing, Amplification, Control
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Cell cycle dependent bi-directional activities of human BRCA2 gene promoter . (A) Genomic context of human BRCA2 gene bi-directional (BD) promoter studied. The numbers shown are with respect to the transcription start site of human BRCA2 gene. (B) Maps of the reporter constructs in pRL-Null vector used in the study. (i) The single reporter constructs: pRL-FP (forward construct) and pRL-RP (reverse construct); (ii) the dual reporter construct. URS: upstream regulatory sequence; Ex-1: exon 1; Int-1: intron 1; Rluc: Renilla luciferase; Fluc: firefly luciferase; ORF: open reading frame. (C) Activities of the BRCA2 (forward) and the ZAR2 (reverse) promoters in different lines of human breast cancer cells at G0/G1 and S/G2 phases of their cell cycles. Results are mean ± SE (n = 6). The differences between the G0/G1 and S/G2 phase cells were statistically significant (shown by '*'; p < 0.001).
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Construct, Plasmid Preparation, Sequencing, Luciferase
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Relative activities of the forward and the reverse promoters of BRCA2 gene in different unsynchronized human breast cancer cells at 95% confluency.
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Luciferase, Activity Assay
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Ratio of the forward (BRCA2) and the reverse (ZAR2) activity in the G0/G1 and S/G2 growth phases of different breast cancer cells using transient transfection with the dual reporter/promoter construct (see Fig. 1B).
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Activity Assay, Transfection, Construct
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: The transcription start sites of the reverse transcript from BRCA2 gene bi-directional promoter . (A) GeneRacer amplification product for ZAR2. See Materials and methods for details. (B) Nucleotide sequence of human ZAR2/BRCA2 bi-directional promoter. The transcriptional start sites (TSSs), as determined by GeneRacer technique, are shown. The segment in green color is the sequence complementary to part of the intron 1 sequence of human BRCA2 gene, the segment in red color is from exon 1 and the blue part is from the upstream sequence of BRCA2 gene. The E-box sequence essential for BRCA2 gene expression [ , ] is underlined. The splice donor site at the ZAR2 gene exon 1/intron 1 junction is indicated by a downward arrow. The 'G' residue at the SNP site at -26 from BRCA2 gene transcription start site is shown by a red *. (C) Cartoon showing the human BRCA2 (upper panel) and ZAR2 (lower panel) gene promoter studied. The identities of ZAR2 exon1 (Ex-1) and intron 1 (Int-1) were experimentally determined in this study. TSS: transcription start site (designated as +1); URS: upstream regulatory sequence.
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Amplification, Sequencing, Gene Expression, Residue
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Conservation of the BRCA2/ZAR2 genetic arrangements in vertebrates . (A) Relative chromosomal locations of BRCA2 and ZAR2 genes in different vertebrates. The maps were obtained from NCBI site for Entrez genes http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene&term=BRCA2+ Not drawn to the scale. (B) Dendrogram with branch lengths for the ZAR2 proteins from different vertebrates. The putative ZAR2 protein amino acid sequences were mined from the NCBI Entrez database and dendrogram with branch length was analyzed by CLUSTALW program http://align.genome.jp/ .
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques:
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: The exon-intron structure and mRNA sequence of human ZAR2 gene . (A) Cartoon showing the exon-intron structure of human ZAR2 gene. The first exon of ZAR2 overlaps with the exon 1 of the BRCA2 gene (not drawn to the scale). (B) Nucleotide sequence of human ZAR2 mature mRNA. The 5'-UTR sequence was experimentally determined (see text for details). The putative protein coding sequence (ORF) is shown in blue and highlighted in gray. The upstream AUG (uAUG) codons at the 5'-UTR are highlighted: out-of-frame uAUGs are in yellow shades; in-frame uAUGs are in green shades. The 5'-UTR sequence overlapping with BRCA2 mRNA sequences are shaded yellow. Rest of the 5'-UTR sequence of ZAR2 mRNA is derived from the newly identified exon 1 and is shown in red.
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Sequencing, Derivative Assay
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Relative expressions of BRCA2 and ZAR2 mRNAs at different cell cycle stages of human breast cells . (A) RT-PCR analysis showing the expressions of BRCA2 and ZAR2 mRNAs in the unsynchronized (mostly dividing) cells. β-Actin mRNA was used as a loading control. (B) Real-time RT-PCR evaluation of the relative levels of BRCA2 and ZAR2 mRNAs in different human breast cancer cells at G0/G1 and S/G2 phases. The differences between the G0/G1 and S/G2 phase cells were statistically significant (shown by '*'; p < 0.001). (C) Immunofluorescence confocal microscopy showing growth phase-dependent localization of N-terminal FLAG-tagged ZAR2 protein in the synchronized MCF7 cells. Anti-FLAG M2 antibody was used for the detection of FLAG-tagged ZAR2 protein in the cells. The cells were transiently transfected with the expression plasmid constructs and thus not all cells are expressing the recombinant protein.
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Reverse Transcription Polymerase Chain Reaction, Control, Quantitative RT-PCR, Immunofluorescence, Confocal Microscopy, Transfection, Expressing, Plasmid Preparation, Construct, Recombinant
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: In vivo binding of ZAR2 protein to the BRCA2/ZAR2 gene promoter . (A) PCR amplification of the immunoprecipitated chromatin DNA fragment pulled down with FLAG antibody from synchronized MCF7 cells over-expressing C-terminal FLAG-tagged ZAR2 protein at the G0/G1 and S/G2 phases. Input DNA (5% was used as control. Chromatin DNA fragments mock precipitated with mouse IgG did not significantly amplified any detectable DNA. BRCA2 gene promoter specific primers were used for PCR amplifications. (B) Quantitative ChIP analysis of ZAR2 recruitment to BRCA2/ZAR2 bi-directional promoter in MCF7 cells at G0/G1 and S/G2 phases. qChIP-PCR analyses were performed with chromatin extracts harvested from cells over expressing C-terminal FLAG-tagged ZAR2. The mean values from triplicate data points are plotted and error bars indicate ± SE. The amplification values are normalized by subtraction with IgG control antibody and then division with 1% input DNA. Data shown were representative of three independent experiments (mean + SE) and the difference between the G0/G1 phase and the S/G2 phase cells was statistically significant (shown by '*'; p < 0.001).
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: In Vivo, Binding Assay, Amplification, Immunoprecipitation, Expressing, Control
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Effects of over-expression (OVEX) of the C-terminal FLAG-tagged ZAR2 in synchronized MCF7 cells on the BRCA2 and ZAR2 mRNA levels (A) and on the activities of BRCA2 and ZAR2 gene promoters (B) at the S/G2 phase . MCF7 cells were stably transfected with C-terminally FLAG-tagged ZAR2 and evaluated for their ZAR2 over expression. Levels of the mRNAs were determined by real-time RT-PCR . Promoter activities were measured in MCF7 cells transiently transfected with the single-reporter constructs (Fig. 1B) following the dual luciferase assay protocols (Promega). pGL3-Control was used as normalization control as described in the 'Methods' section. Results are mean ± SE (n = 6). '*' indicates the difference between the corresponding control and the experimental sets is statistically significant (p < 0.001).
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Over Expression, Stable Transfection, Transfection, Quantitative RT-PCR, Construct, Luciferase, Control
Journal: Molecular Cancer
Article Title: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells
doi: 10.1186/1476-4598-9-50
Figure Lengend Snippet: Effect of knockdown of ZAR2 in synchronized MCF7 cells on the BRCA2 and ZAR2 mRNA levels (A) and on the activities of BRCA2 and ZAR2 gene promoters (B) at the G0/G1 phase . ZAR2 was knocked down in MCF7 cells with two different double-stranded stealth siRNAs (Invitrogen). Levels of the mRNAs were determined by real-time RT-PCR. Promoter activities were measured in MCF7 cells transiently transfected with the single-reporter constructs (Fig. 1B) following the dual luciferase assay protocols (Promega). pGL3-Control was used as normalization control as described in the 'Methods' section. Results are mean ± SE (n = 6). '*' indicates the difference between the corresponding control and the experimental sets is statistically significant (p < 0.001).
Article Snippet: We cloned the 497 bp promoter DNA sequence (-187 to +310) of
Techniques: Knockdown, Quantitative RT-PCR, Transfection, Construct, Luciferase, Control